Journal: Nature genetics

Article Title: Regulation of single-cell genome organization into TADs and chromatin nanodomains

doi: 10.1038/s41588-020-00716-8

Figure Lengend Snippet: a , Western Blot of CTCF and Vinculin (loading control) in CTCF-AID, CTCF-AID + auxin (2 days), and wild-type ESCs. 4 reproducible western blots were performed from different biological replicates. b , OFs and 3D distances between centroids measured for each probe pair located within or between TADs as a function of the genomic distance separating their centers. Graph represents medians and interquartile ranges. A mean of 57 and 51 alleles was analyzed per probe pair in CTCF-AID and CTCF-AID + auxin cells, respectively. c , Mean OF measured from all probe pairs within TADs divided by the mean OF from all probe pairs between TADs. d , Western Blot of RAD21 and Vinculin (loading control) in wild-type ESCs, RAD21-AID and RAD21-AID + auxin (6 hours). 3 reproducible western blots were performed from different biological replicates. e , OFs and 3D distances between centroids measured for each probe pair located within or between TADs as a function of the genomic distance separating their centers. Graph represents medians and interquartile ranges. A mean of 75 and 47 alleles was analyzed per probe pair in RAD21-AID and RAD21-AID + auxin cells, respectively. f , Mean OF measured from all probe pairs within TADs divided by the mean OF from all probe pairs between TADs.

Article Snippet: To generate the RAD21-AID cell line, E14Tg2a cells were transfected using a Neon transfection system, using one million cells and 15 μg of a Rad21-AID-eGFP targeting vector (pEN527, Addgene # 156452) together with 5 μg of a pX330-derived vector encoding Cas9 and a sgRNA against CCACGGTTCCATATTATCTG (pX330-EN1082, Addgene #156450).

Techniques: Western Blot

Journal: Nature genetics

Article Title: Regulation of single-cell genome organization into TADs and chromatin nanodomains

doi: 10.1038/s41588-020-00716-8

Figure Lengend Snippet: a , Hi-C maps from ESCs along with probe locations, either between two adjacent TADs (probe pair 101-102a) or within a TADs (probe pair 102a-102b). b , Representative 3D-SIM images of the probes shown in a in the indicated cell types (probe pairs 101-102a/102a-102b; 52/58, 47/57, 163/130 and 54/61 alleles were analyzed in CTCF-AID, CTCF-AID + auxin, RAD21-AID and RAD21-AID + auxin, respectively). Maximum projections, scale bar: 500 nm. c , OFs and 3D distances between the centroids of the probes shown in a . Boxplots represent median, interquartile ranges and Tukey-style whiskers. n (probe pairs 101-102a/102a-102b) = 52/58, 47/57, 163/130 and 54/61 for CTCF-AID, CTCF-AID + auxin, RAD21-AID and RAD21-AID + auxin, respectively; ***, P < 0.001; **, P < 0.01; *, P < 0.05; two-sided Wilcoxon rank sum tests. d , OFs and 3D distances between centroids measured for each probe pair in CTCF-AID + auxin cells as a function of the genomic distance separating their centers. Graph represents medians and interquartile ranges. A mean of 51 alleles was analyzed per probe pair. e , Mean (± standard deviation “SD”) OF fold change (CTCF-AID + auxin / CTCF-AID) for probe pairs within TADs (n = 7) or between TADs (n = 8); **, P = 0.0019; * P = 0.016; two-sided t -test. f , OFs and 3D distances between centroids measured for each probe pair in RAD21-AID + auxin cells as a function of the genomic distance separating their centers. Graph represents medians and interquartile ranges. A mean of 47 alleles was analyzed per probe pair. g , Mean (± SD) OF fold change (RAD21-AID + auxin / RAD21-AID) for probe pairs within TADs (n = 7) or between TADs (n = 8); **, P = 0.0012; two-sided t -test.

Article Snippet: To generate the RAD21-AID cell line, E14Tg2a cells were transfected using a Neon transfection system, using one million cells and 15 μg of a Rad21-AID-eGFP targeting vector (pEN527, Addgene # 156452) together with 5 μg of a pX330-derived vector encoding Cas9 and a sgRNA against CCACGGTTCCATATTATCTG (pX330-EN1082, Addgene #156450).

Techniques: Hi-C, Standard Deviation

Journal: Nature genetics

Article Title: Regulation of single-cell genome organization into TADs and chromatin nanodomains

doi: 10.1038/s41588-020-00716-8

Figure Lengend Snippet: a , Hi-C map from ESCs along with probe location (TAD #22) and ChIP-seq tracks. b , Top: representative 3D-SIM images of the TAD shown in a (51 alleles were analyzed). White lines represent the boundaries probe segmentations (2D projections). Maximum projections, scale bar = 500 nm. Bottom: 3D views of the segmented TADs shown above (gray mesh) and watershed segmented CNDs (colored objects). c , DAPI staining in ESC (3 nuclei were analyzed). Single z -slice, scale bars = 5 μm and 500 nm in the magnification. d , Extrapolated diameters (diameter of a circle with the same area than the segmented object) of TADs (ranging from 215 to 990 kb), of CNDs within them, and of CNDs measured with DAPI staining. Bins represent 50 nm, n = 804, 1,413 and 3,068, respectively. e , Representative 3D-SIM images of TAD #62 in ESC and ESC + TSA (94 and 74 alleles were analyzed in ESCs and ESCs + TSA, respectively). White lines represent the boundaries of probe segmentations (2D projections). Maximum projections, scale bar = 500 nm. f , CND volumes. Boxplots represent median, interquartile ranges and Tukey-style whiskers. A mean of 296 and 417 CNDs was analyzed per probe in ESCs and ESCs + TSA, respectively; ***, P < 0.001; **, P < 0.01; *, P < 0.05; two-sided Wilcoxon rank sum tests. g , Mean (± SD) number of CNDs per TAD. A mean of 93 and 95 alleles was analyzed per probe in ESCs and ESCs + TSA, respectively; ***, P < 0.001; **, P < 0.01; two-sided Wilcoxon rank sum tests. h , Model of 3D TAD folding. TADs, which form variable structures and are subdivided into smaller CNDs, favor chromatin intermingling in most cells. Their spatial segregation is further exacerbated in differentiated NPCs. Upon CTCF depletion, the cohesin complex can extrude chromatin , through TAD borders, inducing ectopic contacts between adjacent TADs and abolishing preferential intra-TAD interactions. Upon RAD21 depletion, preferential intra-TAD interactions are lost due to the absence of intermingling generated by the cohesin complex. Upon TSA-mediated histone hyper-acetylation, TADs remain spatially segregated while the structural organization of CNDs is disrupted.

Article Snippet: To generate the RAD21-AID cell line, E14Tg2a cells were transfected using a Neon transfection system, using one million cells and 15 μg of a Rad21-AID-eGFP targeting vector (pEN527, Addgene # 156452) together with 5 μg of a pX330-derived vector encoding Cas9 and a sgRNA against CCACGGTTCCATATTATCTG (pX330-EN1082, Addgene #156450).

Techniques: Hi-C, ChIP-sequencing, Staining, Generated

Journal: Nature genetics

Article Title: Regulation of single-cell genome organization into TADs and chromatin nanodomains

doi: 10.1038/s41588-020-00716-8

Figure Lengend Snippet: a , TAD volumes, TAD sphericities, CND volumes, and number of CNDs per TAD (mean ± SD). Boxplots represent median, interquartile ranges, and Tukey-style whiskers. A mean of 84 and 64 alleles was analyzed per probe in CTCF-AID and CTCF-AID + auxin cells, respectively; ***, P < 0.001; **, P < 0.01; *, P < 0.05; two-sided Wilcoxon rank sum tests. b , 3D-SIM images of TAD #62 (59 and 41 alleles were analyzed in CTCF-AID and CTCF-AID + auxin, respectively). White lines represent the boundaries of probe segmentations (2D projections). Maximum projections, scale bar = 500 nm. c , TAD volumes, TAD sphericities, CND volumes, and number of CNDs per TAD (mean ± SD). Boxplots represent median, interquartile ranges and Tukey-style whiskers. A mean of 176 and 116 alleles was analyzed per probe in in RAD21-AID and RAD21-AID + auxin cells, respectively; ***, P < 0.001; **, P < 0.01; two-sided Wilcoxon rank sum tests. d , 3D-SIM images of TAD #112 showing alleles segmented as one (top) or two (bottom) objects. Lines represent the boundaries of probe segmentations (2D projections). Maximum projections, scale bar = 500 nm. e , Cell cycle profiling using DAPI staining (with examples of nucleus segmentation, scale bar = 10 μm). As nucleus size and DAPI intensity reflect cell cycle stage , cutoff values for nucleus area and DAPI integrated intensity were applied to define G1 ESCs. 27% of the population was defined as G1, consistently with flow cytometry measurements . 164 nuclei were analyzed. f , TAD volumes, TAD sphericities, CND volumes, and number of CNDs per TAD (mean ± SD). Boxplots represent median, interquartile ranges and Tukey-style whiskers. n = 48, 77 and 48 for ESC-G1, RAD21-AID + auxin and RAD21-AID + auxin single chromatids, respectively; ***, P < 0.001; two-sided Wilcoxon rank sum tests.

Article Snippet: To generate the RAD21-AID cell line, E14Tg2a cells were transfected using a Neon transfection system, using one million cells and 15 μg of a Rad21-AID-eGFP targeting vector (pEN527, Addgene # 156452) together with 5 μg of a pX330-derived vector encoding Cas9 and a sgRNA against CCACGGTTCCATATTATCTG (pX330-EN1082, Addgene #156450).

Techniques: Staining, Flow Cytometry

Journal: BMC Cell Biology

Article Title: Phosphatidylinositol 3-kinase signaling in proliferating cells maintains an anti-apoptotic transcriptional program mediated by inhibition of FOXO and non-canonical activation of NFκB transcription factors

doi: 10.1186/1471-2121-9-6

Figure Lengend Snippet: Analysis of NFκB binding sites in proliferating cells by chromatin immunoprecipitation . Chromatin fragments from proliferating T98G cells were immunoprecipitated with either anti-p50 ( A ), anti-p52 ( B ), or anti-RelB ( C ) antibody and quantified by real-time PCR. Data are presented as the percentage of input and are the means of 2 independent experiments with anti-p50 and anti-p52 or 3 independent experiments with anti-RelB ± S.E. β- globin was used as the negative control. In panel C , (*) represents statistically significant binding compared to β-globin (assessed by t -test).

Article Snippet: ChIP assays were performed as previously described [ ], except that either 5 μg of p65 antibody, c-Rel antibody, p50 antibody, RelB antibody (Santa Cruz Biotechnology, sc-372, sc-71, sc-114, sc-226), or 5 μl of p52 antibody (Upstate, 06-413) was used for the immunoprecipitations.

Techniques: Binding Assay, Chromatin Immunoprecipitation, Immunoprecipitation, Real-time Polymerase Chain Reaction, Negative Control

Journal: BMC Cell Biology

Article Title: Phosphatidylinositol 3-kinase signaling in proliferating cells maintains an anti-apoptotic transcriptional program mediated by inhibition of FOXO and non-canonical activation of NFκB transcription factors

doi: 10.1186/1471-2121-9-6

Figure Lengend Snippet: PI 3-kinase inhibition causes a decrease in RelB binding . T98G cells were either maintained in serum or treated with 50 μM LY294002 for 4 or 8 hours. Chromatin fragments were immunoprecipitated with anti-RelB antibody and quantified by real-time PCR. Data are presented as the percentage of input and are the means of 3 independent experiments ± S.E. β- globin was used as the negative control. (*) represents statistically significant loss of binding compared to the cells maintained in serum (assessed by t test).

Article Snippet: ChIP assays were performed as previously described [ ], except that either 5 μg of p65 antibody, c-Rel antibody, p50 antibody, RelB antibody (Santa Cruz Biotechnology, sc-372, sc-71, sc-114, sc-226), or 5 μl of p52 antibody (Upstate, 06-413) was used for the immunoprecipitations.

Techniques: Inhibition, Binding Assay, Immunoprecipitation, Real-time Polymerase Chain Reaction, Negative Control